En palabras de DNA

Construye una frase en pro del DNA

Al final de que leas esto, podrás saber que dice aquí: UGUAUUGAAAAUUGUAUUGCUUGUCAUAUUGAUGCU

Imagina que un organismo es como una compleja computadora, puedes acceder a internet, trabajar en cantidad bárbara de programas, jugar, charlar, etcétera, etcétera, etcétera, bueno, lo que tu puedes ver es como una traducción, interpretación o representación de un código que da instrucciones de hacer tal o cual cosa; en términos generales así es como funcionan los seres vivos y el DNA adquiere la función de este código que te menciono, algo en ese código dice que tengas cierta complexión, específicos rasgos faciales o bien, en un caso desafortunado, alguna enfermedad.  Bueno, ¿y qué onda con esto? Aquí tenemos un poco de ganas de ñoñear  y te enseñaremos a escribir mensajitos que solo un pequeñísimo “gremio” podría escribir de memoria.

El DNA además de otras cosillas se compone de bases nitrogenadas que son timina, citocina, adenina, guanina (T,C,A,G), cuando hablamos de código genético hacemos referencia al RNA y este se compone de citocina, adenina, guanina y uracilo (C,A,G, U), este último reemplaza a la timina. Dichas bases nitrogenadas en grupos de 3 forman los conocidos aminoácidos, te apuesto que has oído hablar de ellos. Para ejemplificar: UUU forman el aminoácido fenilalanina (Phe), AGU forman serina (Ser)… mejor te pondremos una tablita:

Fuente: http://2.bp.blogspot.com/-RheKHEe9lJE/Tb4MEZvqJNI/AAAAAAAAAHw/gPSPYYB2tKs/s1600/img052.jpg

Bueno, estos aminoácidos tienen un código de una sola letra, he aquí la parte interesante de la nota, es como si tuviéramos acceso a un abecedario único y extraordinariamente ñoño, basta con que veas la tablita a continuación:


Ahora bien, si tienes esto ¿qué se te ocurre hacer? Claro! un mensajito, solo que tendrás que lidiar con que en este abecedario no tenemos B, Z y otras letrillas, finge que a tu teclado le hacen falta letras y de algún modo sabemos que podrás solucionar el problema 😀

Con esto, ¿¿¿ya sabes que dice la frase del principio???

Tabla 1: http://2.bp.blogspot.com/-RheKHEe9lJE/Tb4MEZvqJNI/AAAAAAAAAHw/gPSPYYB2tKs/s1600/img052.jpg

Tabla 2:http://patentados.com/img/2010/01-descripcion/agonistas-apolipoproteina-i-su-uso-tratar-trastornos.1.png



Introduce tus datos o haz clic en un icono para iniciar sesión:

Logo de WordPress.com

Estás comentando usando tu cuenta de WordPress.com. Cerrar sesión /  Cambiar )

Google+ photo

Estás comentando usando tu cuenta de Google+. Cerrar sesión /  Cambiar )

Imagen de Twitter

Estás comentando usando tu cuenta de Twitter. Cerrar sesión /  Cambiar )

Foto de Facebook

Estás comentando usando tu cuenta de Facebook. Cerrar sesión /  Cambiar )


Conectando a %s